View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17133_low_35 (Length: 238)
Name: NF17133_low_35
Description: NF17133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17133_low_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 226
Target Start/End: Original strand, 15334216 - 15334424
Alignment:
| Q |
18 |
attacatccttgagaagcttgtacctacgtgtggcggtccgtggcgacggagaaggactcttgcccttctccgagccactctcttcacgatcatgttgtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15334216 |
attacatccttgagaagcttgtacctacgtgtggcggtccgtggcgacggagaaggactcttccccttctccgagccactctcttcacgatcatgttgtt |
15334315 |
T |
|
| Q |
118 |
tgataattttctcacccgaatattccgatcggttggttgtcgcgacgatctcatttccggtcaccggtttctttgaattagtgccaatatgtcttgaatt |
217 |
Q |
| |
|
| || ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15334316 |
taatgattttctcacccgaataatccgatcggttggttgtcgcgacgatctcatttccggtcaccggtttctttgaattagtgccaatatgtcttgaatt |
15334415 |
T |
|
| Q |
218 |
attcttctc |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
15334416 |
attcttctc |
15334424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University