View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17133_low_37 (Length: 235)
Name: NF17133_low_37
Description: NF17133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17133_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 20 - 164
Target Start/End: Complemental strand, 6174230 - 6174086
Alignment:
| Q |
20 |
gggagaggatgcaaatttgttcaactcggaagttactagaaaggtggggaatgggaatagttctagtttttgggaggtggcttggagaggagaaatcccg |
119 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
6174230 |
gggagaggatgcaaattggttcaactcggaagctactagaaaggtggggaatgggaatagttctaatttttgggaggtggcttggagaggggaaatccca |
6174131 |
T |
 |
| Q |
120 |
tttcgagttaagtatcctagactttttgcgttgtctaatcaaaaa |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6174130 |
tttcgagttaagtatcctagactttttgcgttgtctaatcaaaaa |
6174086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 6173939 - 6173895
Alignment:
| Q |
167 |
tattatggttgaaaacagatgaaatattatcattctttgatatac |
211 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
6173939 |
tattatggtttaaaacagatgaaatattatcattctttgacatac |
6173895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University