View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17133_low_38 (Length: 227)
Name: NF17133_low_38
Description: NF17133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17133_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 14 - 225
Target Start/End: Complemental strand, 41714348 - 41714141
Alignment:
| Q |
14 |
cagatttgactcataggtactatctacaggtctactttaatttactatccaaaaataagttaatactttatacaataagtcgattccgaattttcttagt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41714348 |
cagatttgactcataggtactatctacaagtctactttaatttactatccaaaaataagttaatactttatacaataagtcgattccgaattttcttagg |
41714249 |
T |
 |
| Q |
114 |
gaaataaataaataatacaagagcttgagagtgctctttcttctcattaaacaagaagaaaacatgtaattgctcttgattttgagattttcttattgct |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41714248 |
gaaataaataa----tacaagagcttgagagtgctctttcttctcattaaacaagaagaaaacatgtaattgctcttcattttgagattttcttattgct |
41714153 |
T |
 |
| Q |
214 |
ttgaaggtattc |
225 |
Q |
| |
|
|||||||||||| |
|
|
| T |
41714152 |
ttgaaggtattc |
41714141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University