View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17133_low_40 (Length: 220)
Name: NF17133_low_40
Description: NF17133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17133_low_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 176
Target Start/End: Complemental strand, 4644465 - 4644295
Alignment:
| Q |
1 |
ctacatcatttaactcattgattgtgtgttgctgcttctccaacgagaatgatactatccatactccatagtattcacgccgcgatttgccttatgtca- |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
4644465 |
ctacatcatttaactcattgattgtgtgttgctgcttctccaacgagaatgatactatccaca-------gtattcacgccgcgatttgccttatgtcac |
4644373 |
T |
|
| Q |
100 |
-gcttgaccatttttccgtcgagctgccaccactaggatgcgaatctctcccgaatgtgcaacaatattctgacttga |
176 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4644372 |
agcttgaccattttgccgtcgagccgccaccactaggatgcgaatctctcctgaatgtgcaacaatattctgacttga |
4644295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University