View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17133_low_41 (Length: 213)
Name: NF17133_low_41
Description: NF17133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17133_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 179
Target Start/End: Original strand, 46994627 - 46994805
Alignment:
| Q |
1 |
tccaaacaaactcaagatattgttaaaccacatgtcggtnnnnnnngacaactatgcccacttgttaaaacttggtgatgactggttgctttccttttgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46994627 |
tccaaacaaactcaagatattgttaaaccacatgtcggtaaaaaaagacaactatgccaacttgttaaaacttggtgatgactggttgctttccttttgc |
46994726 |
T |
 |
| Q |
101 |
acaaatctaattcacaattggtttcttttattcaaacaattatctttagaactcactgctttaaccaacacgaatattt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
46994727 |
acaaatctaattcacaattggtttcttttattcgaacaattatctttagaactcactgctttaactaacacggatattt |
46994805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University