View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17133_low_41 (Length: 213)

Name: NF17133_low_41
Description: NF17133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17133_low_41
NF17133_low_41
[»] chr4 (1 HSPs)
chr4 (1-179)||(46994627-46994805)


Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 179
Target Start/End: Original strand, 46994627 - 46994805
Alignment:
1 tccaaacaaactcaagatattgttaaaccacatgtcggtnnnnnnngacaactatgcccacttgttaaaacttggtgatgactggttgctttccttttgc 100  Q
    |||||||||||||||||||||||||||||||||||||||       |||||||||||| |||||||||||||||||||||||||||||||||||||||||    
46994627 tccaaacaaactcaagatattgttaaaccacatgtcggtaaaaaaagacaactatgccaacttgttaaaacttggtgatgactggttgctttccttttgc 46994726  T
101 acaaatctaattcacaattggtttcttttattcaaacaattatctttagaactcactgctttaaccaacacgaatattt 179  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||||||    
46994727 acaaatctaattcacaattggtttcttttattcgaacaattatctttagaactcactgctttaactaacacggatattt 46994805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University