View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_high_106 (Length: 240)
Name: NF17134_high_106
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_high_106 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 3 - 162
Target Start/End: Complemental strand, 26653013 - 26652854
Alignment:
| Q |
3 |
ttgcttaatttggaaaggctacgttattggccacaaaaattgtactacagtgtataccaagggaaaatgaatggtgaatgtgtgaaaaccccaatgtatc |
102 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26653013 |
ttgcttaatttggaaaggctacgttgttggccacaaaaattgtactacagtgtatacgaagggagaatgaatggtgaatgtgtgaaaaccccaatgtatc |
26652914 |
T |
 |
| Q |
103 |
ctttgttgctagtaattctcacattaaagaaggtgccatttcaattaagtttaggggcaa |
162 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
26652913 |
ctttgttgctagtaattctcacattaaacaaggtgccatttgaattaagtttaggggcaa |
26652854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 78 - 162
Target Start/End: Complemental strand, 26646277 - 26646193
Alignment:
| Q |
78 |
gaatgtgtgaaaaccccaatgtatcctttgttgctagtaattctcacattaaagaaggtgccatttcaattaagtttaggggcaa |
162 |
Q |
| |
|
|||||||||||||||| |||||||||||| | ||||||||| ||| | ||| || ||||||||| |||||||||||||||||| |
|
|
| T |
26646277 |
gaatgtgtgaaaacccagatgtatcctttgcttctagtaattttcaaaacaaacaatgtgccattttaattaagtttaggggcaa |
26646193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 26652833 - 26652793
Alignment:
| Q |
183 |
ggtattcttgtccgttcttct--tgcctggcgtgtgtgtgt |
221 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26652833 |
ggtattcttgtccgttcttctcttgcctggcgtgtgtgtgt |
26652793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University