View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17134_high_126 (Length: 228)

Name: NF17134_high_126
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17134_high_126
NF17134_high_126
[»] scaffold0018 (1 HSPs)
scaffold0018 (1-210)||(155820-156029)
[»] chr1 (1 HSPs)
chr1 (1-210)||(41504298-41504507)


Alignment Details
Target: scaffold0018 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: scaffold0018
Description:

Target: scaffold0018; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 155820 - 156029
Alignment:
1 ctgcggctcatgcgcaatgaacatcgacggctgtaacggactggcttgtttaacgaagattccggatgcggggacggattcgacgataactccattgccg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
155820 ctgcggctcatgcgcaatgaacatcgacggctgtaacggactggcttgtttaacgaagattccggatgcggggacggattcgacgataactccattgccg 155919  T
101 catatgtttgttataaaggatcttgtggttgatatgacgaatttttataatcagtataagagtattgagccgtggttgaagaggaagagtccggccgagg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
155920 catatgtttgttataaaggatcttgtggttgatatgacgaatttttataatcagtataagagtattgagccgtggttgaagaggaagagtccggcggagg 156019  T
201 aagatggaaa 210  Q
    ||||||||||    
156020 aagatggaaa 156029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 41504298 - 41504507
Alignment:
1 ctgcggctcatgcgcaatgaacatcgacggctgtaacggactggcttgtttaacgaagattccggatgcggggacggattcgacgataactccattgccg 100  Q
    |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| ||||| |||||||||    
41504298 ctgcggctcatgtgcgatgaacatcgacggctgtaacggactggcttgtttaacgaagattcctgatgcggggatggattcgacaataacgccattgccg 41504397  T
101 catatgtttgttataaaggatcttgtggttgatatgacgaatttttataatcagtataagagtattgagccgtggttgaagaggaagagtccggccgagg 200  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
41504398 catatgtttgtgataaaggatcttgtggttgatatgacgaatttttataatcagtataagagtattgagccgtggttgaagaggaagagtccggcggagg 41504497  T
201 aagatggaaa 210  Q
    ||||||||||    
41504498 aagatggaaa 41504507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University