View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_high_141 (Length: 210)
Name: NF17134_high_141
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_high_141 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 52316279 - 52316071
Alignment:
| Q |
1 |
tgacccttggaaattaccagatttaatattaaacatttaaaaaatgcaattaccagatttagccatgctatgaaaatgaataaatccaagagttggtctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52316279 |
tgacccttggaaattaccagatttaatattaaacatttaaaaaatgcaattaccagatttagccatgctatgaaaatgaataaatccaagagttggtctc |
52316180 |
T |
 |
| Q |
101 |
aatatnnnnnnngaaacacatccaagttaaaataaaatactgatttgaactccatgagctaagattcataggtgtaggtgtaacatcacagacatataca |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52316179 |
aatataaaaaaagaaacacatccaagttaaaataaaatactgatttgaactccatgagctaagattcataggtgtaggtgtaacatcacagacatataca |
52316080 |
T |
 |
| Q |
201 |
atcttcatgc |
210 |
Q |
| |
|
| |||||||| |
|
|
| T |
52316079 |
a-cttcatgc |
52316071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University