View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_high_36 (Length: 423)
Name: NF17134_high_36
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_high_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 1e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 200 - 407
Target Start/End: Original strand, 50342459 - 50342665
Alignment:
| Q |
200 |
tttattaatttttctttggttgaataggtgattaggtcactaatttaacttgatatttgtttccaaactgtagttgagaatttattgaggcttgccccgg |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| || |
|
|
| T |
50342459 |
tttattaatttttctttggttgaataggtgattaggtcactaatttaacttgatatttgtttccaaactgtagttgagattttgttgaggcttgccctgg |
50342558 |
T |
 |
| Q |
300 |
ctagactagaattctctgcaacggttacggttaccatccaaattgggtcgtgacaaagttgattgtttataagcttggatcgagaatttttggagggaag |
399 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||||| |
|
|
| T |
50342559 |
ctagactagaattctctgcaccggttacggttaccatccaaattgggtcgtgacaaagttgattgtttataagcttgggtcaagaa-ttttggagggaag |
50342657 |
T |
 |
| Q |
400 |
gagggaat |
407 |
Q |
| |
|
|||||||| |
|
|
| T |
50342658 |
gagggaat |
50342665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 151 - 203
Target Start/End: Original strand, 50342370 - 50342423
Alignment:
| Q |
151 |
aaccctgagaa-tgaaaaatgaggatctttgaaattatctgttatgtcttttta |
203 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50342370 |
aaccctgagaaatgaaaaatgaggatctttgaaattatctgttatgtcttttta |
50342423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University