View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17134_high_36 (Length: 423)

Name: NF17134_high_36
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17134_high_36
NF17134_high_36
[»] chr4 (2 HSPs)
chr4 (200-407)||(50342459-50342665)
chr4 (151-203)||(50342370-50342423)


Alignment Details
Target: chr4 (Bit Score: 176; Significance: 1e-94; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 200 - 407
Target Start/End: Original strand, 50342459 - 50342665
Alignment:
200 tttattaatttttctttggttgaataggtgattaggtcactaatttaacttgatatttgtttccaaactgtagttgagaatttattgaggcttgccccgg 299  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| ||    
50342459 tttattaatttttctttggttgaataggtgattaggtcactaatttaacttgatatttgtttccaaactgtagttgagattttgttgaggcttgccctgg 50342558  T
300 ctagactagaattctctgcaacggttacggttaccatccaaattgggtcgtgacaaagttgattgtttataagcttggatcgagaatttttggagggaag 399  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||||||||||||    
50342559 ctagactagaattctctgcaccggttacggttaccatccaaattgggtcgtgacaaagttgattgtttataagcttgggtcaagaa-ttttggagggaag 50342657  T
400 gagggaat 407  Q
    ||||||||    
50342658 gagggaat 50342665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 151 - 203
Target Start/End: Original strand, 50342370 - 50342423
Alignment:
151 aaccctgagaa-tgaaaaatgaggatctttgaaattatctgttatgtcttttta 203  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
50342370 aaccctgagaaatgaaaaatgaggatctttgaaattatctgttatgtcttttta 50342423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University