View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_high_52 (Length: 362)
Name: NF17134_high_52
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_high_52 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 14 - 356
Target Start/End: Complemental strand, 49404170 - 49403828
Alignment:
| Q |
14 |
gaaagggtgaggggatcatataggagtatggtaatacccgtttggaggtcccattccatgaactgggggcattccataaggcataggacctccagcatag |
113 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49404170 |
gaaagcgtgaggggatcatataggagtatggtaatacccgtttggaggtcccattccgtgaactgggggcattccgtaaggcataggacctccagcatag |
49404071 |
T |
|
| Q |
114 |
tatccagtaccattgttcattttgttcaagctagactggccttgcatcccatctctcgcatactgatgccacagctgctgctcatgcacaagtaattgtt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49404070 |
tatccagtaccattgttcattttgttcaagctagactggccttgcatcccatctcttgcatactgatgccacagctgctgctcatgcacaagtaattgtt |
49403971 |
T |
|
| Q |
214 |
gcttcttctccatttcggccatttgcacataggagggaggtggaatgttcaaggatgcagcgaacggatcctgattaactggctgcacagatccatctgg |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49403970 |
gcttcttctccatttcggccatttgcacataggagggaggtggaatgttcaaggatgcagcgaacggatcctgattaactggctgcacagatccatctgg |
49403871 |
T |
|
| Q |
314 |
ggctgggagagctaaaacaggtgttgtggtctttcccggtgcc |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49403870 |
ggctgggagagctaaaacaggtgttgtggtctttcccggtgcc |
49403828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University