View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_high_64 (Length: 327)
Name: NF17134_high_64
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_high_64 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 20 - 285
Target Start/End: Complemental strand, 51770948 - 51770691
Alignment:
| Q |
20 |
agtagtagtagtactagcagcaacatgcaatgacccttatacccttgctcacaaacaggtggtggttctctttgcaaatccaacaacaacctcgttgctc |
119 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51770948 |
agtagtagtagtactagcagca---tgcaatgacccttatacccttgctcacaaacaggtggtggttctctttgcaaatccaacaacaacctcgttgctc |
51770852 |
T |
 |
| Q |
120 |
atcagacattgacatcgtaccattgcatttgcgtccattaaggcagacaggttgaagccaggcnnnnnnnnnnnnnnnnnnnncaaatattacttactac |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
51770851 |
atcagacattgacatcgtaccattgcatttgcgtccattaaggcagacaggttgaagccaggc-----atattatattatatacaaatatt----actac |
51770761 |
T |
 |
| Q |
220 |
cttttctttcattcattcatttcaccaacaacac----ttctttctttcttgatggtataatgaaatttg |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51770760 |
cttttctttcattcattcatttcaccaacaacacttctttctttctttcttgatggtataatgaaatttg |
51770691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University