View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_high_68 (Length: 314)
Name: NF17134_high_68
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_high_68 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 82 - 296
Target Start/End: Original strand, 1547798 - 1548012
Alignment:
| Q |
82 |
ttccaacaaatgtcatatcccacgtttcttaatttatgctttgatttaacggttttcaatatgcgtttagaggcttttgcagaataaataggctaaaatc |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1547798 |
ttccaacaaatgtcatatcccacgtttcttaatttatgctttgatttaacggttttcaatatgcgtttagaggcttttgcagaataaataggctaaaatc |
1547897 |
T |
|
| Q |
182 |
aaatgggtgtgtgggatcgagcagaattttttgaacatagactctaccacaataatgcttgtattttaataccagtgcaatttgtgaccacttctccctt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1547898 |
aaatgggtgtgtgggatcgagcagaattttttgaacatagactctaccacaataatgcttgtattttaataccagtgcaatttgtgaccacttctccctt |
1547997 |
T |
|
| Q |
282 |
tagtaagcatgtttt |
296 |
Q |
| |
|
|||||| |||||||| |
|
|
| T |
1547998 |
tagtaaacatgtttt |
1548012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 5 - 54
Target Start/End: Original strand, 1547721 - 1547770
Alignment:
| Q |
5 |
tatcaatcaattaaaatcactcaattatcagccacttcaacttaagtgtt |
54 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1547721 |
tatcaatcaattaaaatcactcaattattagccacttcaacttaagtgtt |
1547770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 82 - 177
Target Start/End: Complemental strand, 43683687 - 43683591
Alignment:
| Q |
82 |
ttccaacaaatgtcatatcccacgtttcttaatttatgc-tttgatttaacggttttcaatatgcgtttagaggcttttgcagaataaataggctaa |
177 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||| || ||||||||| ||||||||| ||| |||||||||||||||| ||| || ||||||| |
|
|
| T |
43683687 |
ttccaataaatatcatatcccacgtttcttaatttaagcatttgatttagaagttttcaatgtgcatttagaggcttttgcataatgaagaggctaa |
43683591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 229 - 280
Target Start/End: Complemental strand, 43683556 - 43683505
Alignment:
| Q |
229 |
cacaataatgcttgtattttaataccagtgcaatttgtgaccacttctccct |
280 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||| |||||||||| |
|
|
| T |
43683556 |
cacaataatgcttgtattttaataccattgcaatctgtgactacttctccct |
43683505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University