View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_high_70 (Length: 310)
Name: NF17134_high_70
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_high_70 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 301
Target Start/End: Complemental strand, 51964216 - 51963936
Alignment:
| Q |
18 |
cataaaagacttggggttgtggaggatttcacgtgatactgtannnnnnnnnnaccgttgttaactctgtctgtacaacacccgatagagattgcttatc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51964216 |
cataaaagacttggggttgtggaggatttcacgtgatactgtaggggggg---accgttgttaactctgtctgtacaacacccgatagagattgcttatc |
51964120 |
T |
 |
| Q |
118 |
attgccttctcaattcttcctttttcctatggggaatttgtgcccacgtttcacatttcaattaaactaaataattgatcaatatttatgcatttacaac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51964119 |
attgccttctcaattcttcctttttcctatggggaatttgtgcccacgtttcacctttcaattaaactaaataattgatcaatatttatgcatttacaac |
51964020 |
T |
 |
| Q |
218 |
ccggctagaatagatatcagttggcctgtctacaaaatatatttaatgctaatgtcacatatgttttttatgaagaagaataat |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51964019 |
ccggctagaatagatatcagttggcctgtctacaaaatatatttaatgctaatgtcacatatgttttttatgaagaagaataat |
51963936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University