View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_high_92 (Length: 255)
Name: NF17134_high_92
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_high_92 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 233
Target Start/End: Original strand, 49993964 - 49994179
Alignment:
| Q |
18 |
ctatggatttcatgggctgaactggcataggaacaccgtacatggcaccggtgaggaagttatagaagccggtgaaaatcaaagtggtgccaaggttgag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49993964 |
ctatggatttcatgggctgaactggcataggaacaccgtacatggcaccggtgaggaagttatagaagccggtgaaaatcaaagtggtgccaaggttgag |
49994063 |
T |
 |
| Q |
118 |
gtttttggaaagggtgagcgaaagtactattggtatgtatgtgccaaggtcacccatggctccattgagttcagacaatgttgaatggaaatttaagttg |
217 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49994064 |
gtttttggaaagggtgagtgaaagtactattggtatgtatgtgccaaggtcacccatggctccattgagttcagataatgttgaatggaaatttaagttg |
49994163 |
T |
 |
| Q |
218 |
ttttttactttttgta |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
49994164 |
ttttttactttttgta |
49994179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 143 - 208
Target Start/End: Original strand, 25800028 - 25800093
Alignment:
| Q |
143 |
actattggtatgtatgtgccaaggtcacccatggctccattgagttcagacaatgttgaatggaaa |
208 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||| ||||| | ||||| | || ||||||||||| |
|
|
| T |
25800028 |
actatgggtatgtaggtgccaaggtcacccatggcaccatttaattcagcccattttgaatggaaa |
25800093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 137 - 228
Target Start/End: Complemental strand, 1874666 - 1874575
Alignment:
| Q |
137 |
gaaagtactattggtatgtatgtgccaaggtcacccatggctccattgagttcagacaatgttgaatggaaatttaagttgttttttacttt |
228 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||| ||||| ||||||| | || ||||||| ||| ||||||||||| ||||| |
|
|
| T |
1874666 |
gaaagaactattggtatgtaggtgccaaggtcacccatggcaccatttagttcagcccattttgaatgtaaaaccaagttgtttttcacttt |
1874575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University