View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_high_93 (Length: 255)
Name: NF17134_high_93
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_high_93 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 55 - 238
Target Start/End: Original strand, 23352028 - 23352211
Alignment:
| Q |
55 |
ttggaataattgaacaagtttagcatgattggaaatgacgattgtaggtgctatagttagatattgatatggtttcttagcagatacatatattcaaaga |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23352028 |
ttggaataattgaacaagtttagcatgattggaaatgacgattgtaggtgctatagttagatattgatatggtttcttagcagatacatatattcaaaga |
23352127 |
T |
 |
| Q |
155 |
gcagccaaagatagggttagtagtgatgtggatgccaccattttgtgggtagaccacttaattttatctcgttgtgtgtctctc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
23352128 |
gcagccaaagatagggttagtagtgatgtggatgccaccattttgtgggtaggccacttaattttatctcgtcgtgtgtctctc |
23352211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 182 - 223
Target Start/End: Complemental strand, 41188146 - 41188105
Alignment:
| Q |
182 |
gtggatgccaccattttgtgggtagaccacttaattttatct |
223 |
Q |
| |
|
|||||| ||||||||||||||||| | ||||||||||||||| |
|
|
| T |
41188146 |
gtggataccaccattttgtgggtacagcacttaattttatct |
41188105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University