View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_low_101 (Length: 250)
Name: NF17134_low_101
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_low_101 |
 |  |
|
| [»] scaffold0215 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 18850677 - 18850516
Alignment:
| Q |
1 |
tttagattgttaattaaccacctaattactgtagtggtt---tagtttataaacttgaagagctgctgctaaagtgagaagattgagactactagctgat |
97 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18850677 |
tttacattattaattaaccacctaattactgtagtggttcattagtttataaacttgaagagctgctgctaaagtgagaagattgagactactagctgat |
18850578 |
T |
 |
| Q |
98 |
tcaatggcgttgatgggatgaaattagattttgcggacagtcaagagtagtttgatctcttt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18850577 |
tcaatggcgttgatgggatgaaattagattttgcggacagtcaagagtagtttgatctcttt |
18850516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 58 - 160
Target Start/End: Original strand, 16357822 - 16357924
Alignment:
| Q |
58 |
agctgctgctaaagtgagaagattgagactactagctgattcaatggcgttgatgggatgaaattagattttgcggacagtcaagagtagtttgatctct |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
16357822 |
agctgctgctaaagtgagaagattgagactactagctgattcaatggcgttgatgggatgaaagtagattttgcggacagtcaagagtagtttgatctct |
16357921 |
T |
 |
| Q |
158 |
ttg |
160 |
Q |
| |
|
||| |
|
|
| T |
16357922 |
ttg |
16357924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0215 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: scaffold0215
Description:
Target: scaffold0215; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 160
Target Start/End: Original strand, 23769 - 23931
Alignment:
| Q |
1 |
tttagattgttaattaaccacctaattactgtagtggtt---tagtttataaacttgaagagctgctgctaaagtgagaagattgagactactagctgat |
97 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23769 |
tttacattattaattaaccacctaattactgtagtggttcattagtttataaacttgaagagctgctactaaagtgagaagattgagactactagctgat |
23868 |
T |
 |
| Q |
98 |
tcaatggcgttgatgggatgaaattagattttgcggacagtcaagagtagtttgatctctttg |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23869 |
tcaatggcgttgatgggatgaaattagattttgcggacaatcaagagtagtttgatctctttg |
23931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 161 - 242
Target Start/End: Original strand, 11464404 - 11464485
Alignment:
| Q |
161 |
tgatgcgaaaattgatccagaagagcttgaaatcagcacacgtgacaatcaccaaggagctagtggcgtggggtcctttgct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11464404 |
tgatgcgaaaattgatccagaagagcttgaaatcagcacacgtgacaatcaccaaggagctagtggcgtggggtcctttgct |
11464485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 161 - 242
Target Start/End: Original strand, 11459422 - 11459503
Alignment:
| Q |
161 |
tgatgcgaaaattgatccagaagagcttgaaatcagcacacgtgacaatcaccaaggagctagtggcgtggggtcctttgct |
242 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11459422 |
tgatgcgaaaattgatctagaagagcttgaaatcagcacacgtgacaatcaccaaggagctagtggcgtggggtcctttgct |
11459503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 58 - 160
Target Start/End: Complemental strand, 21185400 - 21185300
Alignment:
| Q |
58 |
agctgctgctaaagtgagaagattgagactactagctgattcaatggcgttgatgggatgaaattagattttgcggacagtcaagagtagtttgatctct |
157 |
Q |
| |
|
|||||||||||||||||||||||||| ||| || |||||||||||||| |||||| ||||| | ||||||| |||||||| |||| |||| |||||| |
|
|
| T |
21185400 |
agctgctgctaaagtgagaagattgaaacttctggctgattcaatggccttgatgagatgagagtagatttcaaggacagtc--gagtggtttaatctct |
21185303 |
T |
 |
| Q |
158 |
ttg |
160 |
Q |
| |
|
||| |
|
|
| T |
21185302 |
ttg |
21185300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University