View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_low_107 (Length: 243)
Name: NF17134_low_107
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_low_107 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 51 - 225
Target Start/End: Original strand, 882678 - 882860
Alignment:
| Q |
51 |
agggataataatacaatctaaaatactatgatctaatttaagacaccatctcaa------ggccatt--ctgagccagaataggagaaattaagannnnn |
142 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
882678 |
agggataataatacaatctgaaattctatgatctaatttaagacaccatctcaacctcaaggccattgcctgagccagaataggagaaattaagattttt |
882777 |
T |
|
| Q |
143 |
nnaaaggtgtgttgtagatgtaaccgcaggcaacatagaaactaaaggtgttgtaagtagtctgtttgcacatgcctatattc |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
882778 |
ttaaaggtgtgttgtagatgtaaccgcaggcaacatagaaactaaaggtgttgtaagtagtctgtttgcacatgcctatattc |
882860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University