View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_low_11 (Length: 592)
Name: NF17134_low_11
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 430; Significance: 0; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 430; E-Value: 0
Query Start/End: Original strand, 13 - 458
Target Start/End: Complemental strand, 35022146 - 35021701
Alignment:
| Q |
13 |
agatgaattagtatcggagaggaattggagaagtggaccgatcaggttaacgccgggaatttcttgaaacgaggcggaggaaggtggaaaaggggaagtt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35022146 |
agatgaattagtatcggagaggaattggagaagtggaccgatcaggttaacgccgggaatttcttgaaacgcggcggaggaaggtggaaaaggggaagtt |
35022047 |
T |
|
| Q |
113 |
acggcggtgacgaaggagaaggaagttgaaacggagattttacgaatgccgaggtcgcgaagggagatgtgaacgttggagatggcgggaaggaggttgt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35022046 |
acggcggtgacgaaggagaaggaagttgaaacggagattttacgaataccgaggtcgcgaagggagatgtgaacgttggagatggcgggaaggaggttgt |
35021947 |
T |
|
| Q |
213 |
tgatggattcagggtaaacgtcggtgaaggcgttaccgacggagatggtggtgattttggcgcgtgggtagaagggaagcacgtgagtgtagatccatgc |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35021946 |
tgatggattcagggtaaacgtcggtgaaggcgttaccgacggagatggtggtgattttggcgcgtgggtagaagggaagcacgtgagtgtagatccatgc |
35021847 |
T |
|
| Q |
313 |
acgtgcgatggagcggttagtagcgatgtgagtgacgaggtagttggggattgtgaggaagagggagatgttggtgtagagaagagaacggattatggat |
412 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35021846 |
acgtgcgatggagcggttagtggcgatgggagtgacgaggtagttggggattgtgaggaagagggagatgttggtgtagagaagagaacggattatggat |
35021747 |
T |
|
| Q |
413 |
gggtcgggttcttcgagacggaggtgagtgagtttgagattttgca |
458 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35021746 |
gggtcgggttcttcgagacggaggtgagtgagtttgagattttgca |
35021701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 530 - 573
Target Start/End: Complemental strand, 35021638 - 35021595
Alignment:
| Q |
530 |
tatgtgacgccgattgtggggagggaggtggtggttgttgggag |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35021638 |
tatgtgacgccgattgtggggagggaggtggtggttgttgggag |
35021595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 73; Significance: 5e-33; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 147 - 235
Target Start/End: Original strand, 42811487 - 42811575
Alignment:
| Q |
147 |
agattttacgaatgccgaggtcgcgaagggagatgtgaacgttggagatggcgggaaggaggttgttgatggattcagggtaaacgtcg |
235 |
Q |
| |
|
|||||||| | |||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42811487 |
agattttatggatgccgaggtcgtgaagggagatgtgaacgttggagatggcggggaggaggttgttgatggattcagggtaaacgtcg |
42811575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University