View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_low_115 (Length: 239)
Name: NF17134_low_115
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_low_115 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 94 - 239
Target Start/End: Complemental strand, 54850019 - 54849874
Alignment:
| Q |
94 |
cgtgatgaaaccaaaaacacactaacaagtaatgttcaatgcgaaaaattgcaaagattgaagatcaaagatgaatatcaacgaaagtgatgagtaacca |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
54850019 |
cgtgatgaaaccaaaaacacactaacaagtaatgttcaatgcgaaaaattgcaaagattgaagatcaaagatgaatatcaacgaaagtgataagtaacca |
54849920 |
T |
 |
| Q |
194 |
acaaaacagttaggaacgtaactagatttctctcaagagaaaaact |
239 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
54849919 |
acaaaacagttaggaacgtaattagatttctctcaagagaaaaact |
54849874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University