View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_low_116 (Length: 238)
Name: NF17134_low_116
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_low_116 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 8556825 - 8556605
Alignment:
| Q |
18 |
gataaaaggttgcagaggttatggctactacacaacttgaaacaaaagaaacaaaaatagtagatgagaaagtaagttacctgaacataaaggacgcttt |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8556825 |
gataaaaggttgcagagtttatggctactaagcaacttgaaacaaaagaaacaaaaatagtagatgagaaagtaagttacctgaacataaaggacgcttt |
8556726 |
T |
 |
| Q |
118 |
gaggttgaagaccagtattatggaagtaaaagtagtgattaacacctcttttgaaaggagtgctataacgaggatgatcaaacacctttttgattgtttc |
217 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8556725 |
gaggttgaagaccagtattgtggaagtaaaagtagtgattaacacctcttttgaaaggagtggtataacgaggatgatcaaacacctttttgattgtttc |
8556626 |
T |
 |
| Q |
218 |
accaagtttggttctacaatc |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
8556625 |
accaagtttggttctacaatc |
8556605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 98 - 238
Target Start/End: Complemental strand, 8552397 - 8552271
Alignment:
| Q |
98 |
ctgaacataaaggacgctttgaggttgaagaccagtattatggaagtaaaagtagtgattaacacctcttttgaaaggagtgctataacgaggatgatca |
197 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||| |||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
8552397 |
ctgaacataaaggacactttgaggttgaagaccagtatta--------------gtgattagcacctcttttgaaaggagcggtataacgaggatgatca |
8552312 |
T |
 |
| Q |
198 |
aacacctttttgattgtttcaccaagtttggttctacaatc |
238 |
Q |
| |
|
|||| ||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
8552311 |
aacaactttttgatagtttcaccaagtttggctctacaatc |
8552271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University