View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_low_124 (Length: 236)
Name: NF17134_low_124
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_low_124 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 15 - 166
Target Start/End: Original strand, 21131925 - 21132076
Alignment:
| Q |
15 |
agtaacaatatagcacgcttgaaattcgacgaaagcttgaaagccatgtattgttttccactgtccaatttctgtttcattgcttttcgtggattaatgc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21131925 |
agtaacaatatagcacgcttgaaattcgacgaaagcttgaaagccgtgtattgttttccaccatccaatttctgtttcattgcttttcgtggattaatgc |
21132024 |
T |
|
| Q |
115 |
attgtcctataaagcacacagctcgtaatgataacaagtacagatatttact |
166 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21132025 |
attgtcctataaagcacacagctcataatgataacaagtacagatatttact |
21132076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 196 - 236
Target Start/End: Original strand, 21132106 - 21132146
Alignment:
| Q |
196 |
ttgaacatgtccttgaatatttctcatccttccttacgtgc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21132106 |
ttgaacatgtccttgaatatttctcatccttccttaggtgc |
21132146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University