View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_low_126 (Length: 233)
Name: NF17134_low_126
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_low_126 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 16 - 215
Target Start/End: Original strand, 30636482 - 30636682
Alignment:
| Q |
16 |
aatactaacatcatcaaataattcatttgtgctaacgacaatcaaagaatggnnnnnnnncccatcccttcttccatactttggatatgtgaaa-gcagt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30636482 |
aatactaacatcatcaaataattcatttgtgctaacgacaatcaaagaatggaaaaaacacccatcccttcttccatactttggatatgtgaaaagcagt |
30636581 |
T |
 |
| Q |
115 |
cacgaaataataagaaaataaatacatagcttttgaaccacaacataataaaagatgacactaccttattctctcacattcatttgaagtcaattcacaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30636582 |
cacgaaataataagaaaataaatacatagcttttgaaccacaacataataaaagatgacactaccttattctctcacattcatttgaagtcaattcacaa |
30636681 |
T |
 |
| Q |
215 |
c |
215 |
Q |
| |
|
| |
|
|
| T |
30636682 |
c |
30636682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University