View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_low_127 (Length: 233)
Name: NF17134_low_127
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_low_127 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 6e-95; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 13 - 219
Target Start/End: Complemental strand, 32018631 - 32018418
Alignment:
| Q |
13 |
cattattattatagtaggttttgttccattcgttatagccgaaatttatctcattatgcttctgaaatatcacacaaaaatttgatgttt-------aaa |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| ||| |
|
|
| T |
32018631 |
cattattattatagtaggttttgttccattcgttatagccgaaatttatctcattatgcttctgaaataccacacaaaaatttgatattttatttctaaa |
32018532 |
T |
 |
| Q |
106 |
atataatagtttgctcaattcgtttatgtgtttcattattcgttgagtttatttggattgtttagttatagatagtttacttgaagaaagtcatctatta |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32018531 |
atataatagtttgctcaattcgtttatgtgtttcattattcgttgagtttatttggattgtttagttatagatagtttacttgaagaaagtcatctatta |
32018432 |
T |
 |
| Q |
206 |
tatgcatgtgaagt |
219 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
32018431 |
tatacatgtgaagt |
32018418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 102 - 188
Target Start/End: Original strand, 39917849 - 39917934
Alignment:
| Q |
102 |
taaaatataatagtttgctcaattcgtttatgtgtttcattattcgttgagtttatttggattgtttagttatagatagtttacttg |
188 |
Q |
| |
|
|||||||||||| ||| | |||||| || |||||||| |||||| |||||| ||| ||||||||||||||||||| ||||||||| |
|
|
| T |
39917849 |
taaaatataatatttttcacaattcattcatgtgtttgattattgtgtgagttgatt-ggattgtttagttatagatggtttacttg |
39917934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 38 - 75
Target Start/End: Original strand, 39823774 - 39823811
Alignment:
| Q |
38 |
ccattcgttatagccgaaatttatctcattatgcttct |
75 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
39823774 |
ccatttgttatagccgaagtttatctcattatgcttct |
39823811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University