View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_low_131 (Length: 228)
Name: NF17134_low_131
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_low_131 |
 |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0018 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 155820 - 156029
Alignment:
| Q |
1 |
ctgcggctcatgcgcaatgaacatcgacggctgtaacggactggcttgtttaacgaagattccggatgcggggacggattcgacgataactccattgccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
155820 |
ctgcggctcatgcgcaatgaacatcgacggctgtaacggactggcttgtttaacgaagattccggatgcggggacggattcgacgataactccattgccg |
155919 |
T |
 |
| Q |
101 |
catatgtttgttataaaggatcttgtggttgatatgacgaatttttataatcagtataagagtattgagccgtggttgaagaggaagagtccggccgagg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
155920 |
catatgtttgttataaaggatcttgtggttgatatgacgaatttttataatcagtataagagtattgagccgtggttgaagaggaagagtccggcggagg |
156019 |
T |
 |
| Q |
201 |
aagatggaaa |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
156020 |
aagatggaaa |
156029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 41504298 - 41504507
Alignment:
| Q |
1 |
ctgcggctcatgcgcaatgaacatcgacggctgtaacggactggcttgtttaacgaagattccggatgcggggacggattcgacgataactccattgccg |
100 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| ||||| ||||||||| |
|
|
| T |
41504298 |
ctgcggctcatgtgcgatgaacatcgacggctgtaacggactggcttgtttaacgaagattcctgatgcggggatggattcgacaataacgccattgccg |
41504397 |
T |
 |
| Q |
101 |
catatgtttgttataaaggatcttgtggttgatatgacgaatttttataatcagtataagagtattgagccgtggttgaagaggaagagtccggccgagg |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41504398 |
catatgtttgtgataaaggatcttgtggttgatatgacgaatttttataatcagtataagagtattgagccgtggttgaagaggaagagtccggcggagg |
41504497 |
T |
 |
| Q |
201 |
aagatggaaa |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
41504498 |
aagatggaaa |
41504507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University