View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_low_133 (Length: 226)
Name: NF17134_low_133
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_low_133 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 20 - 207
Target Start/End: Original strand, 36040658 - 36040843
Alignment:
| Q |
20 |
aacttatcacatttccatccctacttcagtgaggtacttgttgctgggtgtagtgcgcccttattgctttctttaggttatctattggtaggttgggcag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36040658 |
aacttatcacatttccatccctacttcagtgaggtacttgttgctgggtgtagtgc--ccttattgctttctttaggttatctattggtaggttgggcag |
36040755 |
T |
|
| Q |
120 |
aaatacgagtatgcatttctctaatttggtcttcttgtctaatgaatcattttcaataaatatttgtaaacttttcataacctcattt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36040756 |
aaatacgagtatgcatttctctaatttggtcttcttgtctaatgaatcattttcaataaatatttgtaaacttttcataacctcattt |
36040843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University