View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_low_135 (Length: 225)
Name: NF17134_low_135
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_low_135 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 95 - 211
Target Start/End: Original strand, 20769069 - 20769185
Alignment:
| Q |
95 |
ttacacatcaaataatataatttccataccacgtcatcatgaagaaaacccataattaactgtagcatactagctagagtagagacaagagatgacacat |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20769069 |
ttacacatcaaataatataatttccataccacgtcatcatgaagaaaacccataattaactgtagcatactagctagagtagagacaagagatgacacat |
20769168 |
T |
|
| Q |
195 |
tattatgtgaagatact |
211 |
Q |
| |
|
||||| ||||||||||| |
|
|
| T |
20769169 |
tattacgtgaagatact |
20769185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 16 - 72
Target Start/End: Original strand, 20768990 - 20769046
Alignment:
| Q |
16 |
tattctgaaaattaaataataagataaacagaatgacatttttatgattattactac |
72 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||| | |||||||| ||||||||||| |
|
|
| T |
20768990 |
tattctgaaaattaaataataggatgaacagaataaaatttttataattattactac |
20769046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University