View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_low_141 (Length: 216)
Name: NF17134_low_141
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_low_141 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 8e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 19 - 138
Target Start/End: Complemental strand, 44999665 - 44999549
Alignment:
| Q |
19 |
tatcctcaaaaccgtatgttgggatggcgtgaatttgttgatggaaaggtatttttatgatgacagtcagtccattttattttgtgtttatgtcatgtag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44999665 |
tatcctcaaaaccgtatgttgggatggcgtgaatttgttgatggaaaggtattttt---atgacagacagtccattttattttgtgtttatgtcatgtag |
44999569 |
T |
 |
| Q |
119 |
actatatgacaaggaaattg |
138 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
44999568 |
actatatgacaaggaaattg |
44999549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 200
Target Start/End: Complemental strand, 44999520 - 44999492
Alignment:
| Q |
172 |
gtttggatcatatgtgtggaagacatata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44999520 |
gtttggatcatatgtgtggaagacatata |
44999492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 68
Target Start/End: Original strand, 38764175 - 38764223
Alignment:
| Q |
20 |
atcctcaaaaccgtatgttgggatggcgtgaatttgttgatggaaaggt |
68 |
Q |
| |
|
||||||||||||| ||| | ||||||||| || |||||||||||||||| |
|
|
| T |
38764175 |
atcctcaaaaccgcatgcttggatggcgtaaaattgttgatggaaaggt |
38764223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University