View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_low_145 (Length: 210)
Name: NF17134_low_145
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_low_145 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 78 - 192
Target Start/End: Complemental strand, 49698331 - 49698217
Alignment:
| Q |
78 |
catgtaaccagaatatatgggggaaaaatatgcatgtgtctctataactgcctcagacccgtctcactttctttctattacgtctatgtttggttggcca |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49698331 |
catgtaaccagaatatatgggggaaaaatatgcatgtgtctctacaactgcctcagacccgtctcactttctttctattacgtctatgtttggttggcca |
49698232 |
T |
|
| Q |
178 |
cgagcaattttactc |
192 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
49698231 |
cgagcaattttactc |
49698217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University