View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_low_46 (Length: 393)
Name: NF17134_low_46
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_low_46 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 10551391 - 10551299
Alignment:
| Q |
1 |
atggagtcagaagatcaagctacaaataaaagaatgaaagaaacatggcaactttgttgctgattgtcatcttcaaaaggacaagtccaagaa |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10551391 |
atggagtcagaagatcaagctacaaataaaagaatgaaagaaacatggcaactttgttgctgattgtcatcttcaaaaggacaagtccaagaa |
10551299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 199 - 258
Target Start/End: Complemental strand, 10551152 - 10551093
Alignment:
| Q |
199 |
ctcaactgattcttttctcttctcaatccttatcactttagacattctgttcacccctaa |
258 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
10551152 |
ctcagctggttcttttctcttctcaatccttatcactttagaccttctattcacccctaa |
10551093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University