View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_low_61 (Length: 335)
Name: NF17134_low_61
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_low_61 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 8e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 80 - 321
Target Start/End: Complemental strand, 25650374 - 25650131
Alignment:
| Q |
80 |
tttcccttccttagaaacaaataagaacttgttagaacca-tgtttcaccaacgttagagtaagtgacaacagctaaacttttttgtttcattcctcata |
178 |
Q |
| |
|
||||||||||| ||||| |||| ||||||||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25650374 |
tttcccttcctcagaaataaatcagaacttgttagaacaaatgtttgaccaacgttagagtaagtgacaacagctaaacttttttgtttcattcctcatt |
25650275 |
T |
|
| Q |
179 |
tgtgggtcccaaatcaaagagttgaatcgaaagactcacac--tcactcacctacttcagtttcatttaccttctgatttggttatcatgtctaatcagt |
276 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| |||||| | ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
25650274 |
tgtgggtcccaaatcaaaaggttaaatcgaaacactcactccctcactcacctacttcagtt-catttaccttctgatttggttatcatgtctaatcact |
25650176 |
T |
|
| Q |
277 |
agctaatgaattaactgaatgcaatcatgatttcacggattaaca |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25650175 |
agctaatgaattaactgagtgcaatcatgatttcacggattaaca |
25650131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University