View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_low_69 (Length: 315)
Name: NF17134_low_69
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_low_69 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 313
Target Start/End: Complemental strand, 30700949 - 30700641
Alignment:
| Q |
1 |
tgactgggcccaaggctcggtcctcggtggccccacaactcatctttaaaatagatttgatccgtcaattgtttcactagttctctcaatccaccctaat |
100 |
Q |
| |
|
|||||||||| ||||||| |||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30700949 |
tgactgggcc-aaggctcagtcctccgtggccccacaactcatctttaaaatagacttgatccgtcaattgtttcactagttctctcaatccaccctaat |
30700851 |
T |
|
| Q |
101 |
gcattcaatgacgttctggcgatcatcgacccaactattgaagg-------ttgtaatgacttggctttactccaccatgactctccttttcgtaaatgt |
193 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30700850 |
acattcaatgaccttctggcgatcaccgacccaactattgaaggttgttgtttgtaatgacttggctttactccaccatgactctccttttcgtaaatgt |
30700751 |
T |
|
| Q |
194 |
ataaatacatactttcatattgtaatgcaaggtatatcttttttccacctaaaaatttatcactcttcaccctcttctctttctcaatacacgtcacagt |
293 |
Q |
| |
|
|||||| ||||||||||| || |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30700750 |
ataaatgcatactttcat----------aatgtatatcttttttccacctaaaaacttatcactcttcaccctcttctctttctcaatacacgtcacagt |
30700661 |
T |
|
| Q |
294 |
tacattttcatctcactcga |
313 |
Q |
| |
|
|||||||||| |||||||| |
|
|
| T |
30700660 |
tacattttcaaatcactcga |
30700641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University