View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17134_low_83 (Length: 289)

Name: NF17134_low_83
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17134_low_83
NF17134_low_83
[»] chr6 (1 HSPs)
chr6 (217-280)||(26015794-26015857)
[»] chr4 (1 HSPs)
chr4 (217-280)||(56110028-56110091)


Alignment Details
Target: chr6 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 217 - 280
Target Start/End: Complemental strand, 26015857 - 26015794
Alignment:
217 aagacaattaagtgaaaattcaaaatgcatctactaactaaatattaaatcacctaagaataat 280  Q
    ||||||||||  |||||| |||||||| ||||||||||||||||||||||||||||||||||||    
26015857 aagacaattagttgaaaactcaaaatgtatctactaactaaatattaaatcacctaagaataat 26015794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 217 - 280
Target Start/End: Complemental strand, 56110091 - 56110028
Alignment:
217 aagacaattaagtgaaaattcaaaatgcatctactaactaaatattaaatcacctaagaataat 280  Q
    ||||||||||  |||||| |||||||| ||||||||||||||||||||||||||||||||||||    
56110091 aagacaattagttgaaaactcaaaatgtatctactaactaaatattaaatcacctaagaataat 56110028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University