View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_low_86 (Length: 278)
Name: NF17134_low_86
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_low_86 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 142 - 265
Target Start/End: Original strand, 39975438 - 39975561
Alignment:
| Q |
142 |
gatggactaacttcataagcatatacatatataggatcatcatcaatagcattttttcaaattactaacttgtggaacaatcccttcattccctgcaagc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39975438 |
gatggactaacttcataagcatatacatatataggatgatcatcaatagcattttttcaaattactaacttgttgaacaatcccttcattccctgcaagc |
39975537 |
T |
 |
| Q |
242 |
atcatatacttatccctcctagta |
265 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
39975538 |
atcatatacttatccctcctagta |
39975561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 39975310 - 39975395
Alignment:
| Q |
20 |
caagacactttcattccttcaatgtcacaactcataaatgtcatatcaaacaagaacaagcaagacaacaaattaatttggaaacc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39975310 |
caagacactttcattccttcaatgtcacaactcataaatgtcatatcaaacaagaacaagcaagacaacaaattaatttggaaacc |
39975395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University