View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_low_87 (Length: 277)
Name: NF17134_low_87
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_low_87 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 4 - 194
Target Start/End: Original strand, 50342156 - 50342346
Alignment:
| Q |
4 |
ggatgattcacaaaattgcactattctttatttcattaagatcactattcataaattttgcaacagtagtaattaattgagttggttagttacagctaac |
103 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50342156 |
ggatgattcataaaattgcactattctttatttcattaagatcactattcataaattttgcaacagtagtaattaattgagttggttagttacagctaac |
50342255 |
T |
|
| Q |
104 |
tccaacactaactaatacatttaaattactttttaacacttcccttcaattcaaatgtagtctcaatgtgtttgctctttccatgagacac |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50342256 |
tccaacactaactaatacatttaaattactttttaacacttcccttcaattcaaatgtagtctcaatgtgtttgctctttccatgagacac |
50342346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University