View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_low_93 (Length: 262)
Name: NF17134_low_93
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_low_93 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 18 - 93
Target Start/End: Original strand, 2136494 - 2136569
Alignment:
| Q |
18 |
aaggatttgattctgtttctctcaaggctgtttcttaaacagaagagggggtgagtgagaagaaatggtgaacatt |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2136494 |
aaggatttgattctgtttctctcaaggctgtttcttaaacagaagagggggtgagtgagaagaaatggtgaacatt |
2136569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 176 - 250
Target Start/End: Original strand, 2136648 - 2136721
Alignment:
| Q |
176 |
agccccaataatttaaaacggagatgtacccgtatcggatgttgacattctgcagatacttcaaatacgtaccta |
250 |
Q |
| |
|
|||||||||||| ||||| | |||||||||||||||||||||||| ||| | || ||||||| |||||||||||| |
|
|
| T |
2136648 |
agccccaataatctaaaatg-agatgtacccgtatcggatgttgatattatacatatacttcgaatacgtaccta |
2136721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University