View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17134_low_99 (Length: 252)
Name: NF17134_low_99
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17134_low_99 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 45 - 241
Target Start/End: Original strand, 277646 - 277857
Alignment:
| Q |
45 |
ataaataaataatccatataagagttaagtaatgtttctaaataactaactaactatttaacctgcctcctcttcagtcttcaggcttaagtggtcccat |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
277646 |
ataaataaataatccatataagagttaagtaatgtttctaaataactaactaactatttaacctggctcctcttcagtcttcaggcttaagtggtcccat |
277745 |
T |
|
| Q |
145 |
acctgagc------------------atatattaacactttgtcagatgctaattattggcaattatatgtatattcagatctcttcttcatataaggat |
226 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
277746 |
acctgagcatatatatatatatatatatatattaagactttgtcagatgctaattattggcaattatatgtatattcagatc---tcttcatataaggat |
277842 |
T |
|
| Q |
227 |
gaagtcactccctat |
241 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
277843 |
gaagtcactccctat |
277857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University