View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17135_high_13 (Length: 272)
Name: NF17135_high_13
Description: NF17135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17135_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 46 - 258
Target Start/End: Complemental strand, 25122966 - 25122755
Alignment:
| Q |
46 |
atggtcattgacacctaaatctaatagtcaatagtcataagtagtatgcatagaacaagaaataacactatatataccaatctgataagcatcactaggt |
145 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
25122966 |
atggtcattgacacctgaatctaatagtcaatagtcatgagtagtatgcatagaacaagaaataacactatatatacctatctgagaagcatcactaggt |
25122867 |
T |
|
| Q |
146 |
gagtgacctaggtattacgaggtacctatctagagccattctcgttagcgccaccattagttgtacctttgccacaatgctgatactttcttgcattaga |
245 |
Q |
| |
|
|| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
25122866 |
gaatgacctaggtatgacgaggtacctatctagagccattctcgttagcgccaccattagttgtacctttgccacaatgctgattc-ttcttgcattaga |
25122768 |
T |
|
| Q |
246 |
agcattgatgaat |
258 |
Q |
| |
|
||||||||||||| |
|
|
| T |
25122767 |
agcattgatgaat |
25122755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University