View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17135_low_12 (Length: 273)

Name: NF17135_low_12
Description: NF17135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17135_low_12
NF17135_low_12
[»] chr8 (2 HSPs)
chr8 (1-114)||(34089147-34089260)
chr8 (164-267)||(34089314-34089417)


Alignment Details
Target: chr8 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 34089147 - 34089260
Alignment:
1 gtttgcttttttgtgcatagaaagagaaggaagagagcaaaagccggaagaggtaaacaaagtagaacaactcaggtattgtattggcacatttctggat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34089147 gtttgcttttttgtgcatagaaagagaaggaagagagcaaaagccggaagaggtaaacaaagtagaacaactcaggtattgtattggcacatttctggat 34089246  T
101 cctttgaattgaaa 114  Q
    ||||||||||||||    
34089247 cctttgaattgaaa 34089260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 164 - 267
Target Start/End: Original strand, 34089314 - 34089417
Alignment:
164 cccattgatagagattatatgctcatcttttttgacacgacgcctttactagggtgggactccagcgtcagaccactcactagtttatgatccattattt 263  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34089314 cccattgatagagattatatgctcatcttttttgacacgacgcctttactagggtgggactccagcgtcagaccactcactagtttatgatccattattt 34089413  T
264 tctt 267  Q
    ||||    
34089414 tctt 34089417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University