View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17135_low_12 (Length: 273)
Name: NF17135_low_12
Description: NF17135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17135_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 34089147 - 34089260
Alignment:
| Q |
1 |
gtttgcttttttgtgcatagaaagagaaggaagagagcaaaagccggaagaggtaaacaaagtagaacaactcaggtattgtattggcacatttctggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34089147 |
gtttgcttttttgtgcatagaaagagaaggaagagagcaaaagccggaagaggtaaacaaagtagaacaactcaggtattgtattggcacatttctggat |
34089246 |
T |
 |
| Q |
101 |
cctttgaattgaaa |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
34089247 |
cctttgaattgaaa |
34089260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 164 - 267
Target Start/End: Original strand, 34089314 - 34089417
Alignment:
| Q |
164 |
cccattgatagagattatatgctcatcttttttgacacgacgcctttactagggtgggactccagcgtcagaccactcactagtttatgatccattattt |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34089314 |
cccattgatagagattatatgctcatcttttttgacacgacgcctttactagggtgggactccagcgtcagaccactcactagtttatgatccattattt |
34089413 |
T |
 |
| Q |
264 |
tctt |
267 |
Q |
| |
|
|||| |
|
|
| T |
34089414 |
tctt |
34089417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University