View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17135_low_15 (Length: 262)
Name: NF17135_low_15
Description: NF17135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17135_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 155
Target Start/End: Original strand, 3775582 - 3775736
Alignment:
| Q |
1 |
taggaaaacatatcatttggttccatggcatcacatggctgaatctgaataggtgtgtggcgtagttgttggctcatgattgcgtcatttcattgactcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3775582 |
taggaaaacatatcatttggttccatggcatcacatggctgaatctgaataggtgtgtggcgtagttgttggctcatgattgcgtcatttcattgactcg |
3775681 |
T |
 |
| Q |
101 |
catgcatcatataaagaaacaagggaaatgctaactcatttaattgtttttgtag |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3775682 |
catgcatcatataaagaaacaagggaaatgctaactcatttaattgtttttgtag |
3775736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 53 - 109
Target Start/End: Original strand, 3782539 - 3782595
Alignment:
| Q |
53 |
gtgtgtggcgtagttgttggctcatgattgcgtcatttcattgactcgcatgcatca |
109 |
Q |
| |
|
||||||||||| |||||||| ||| | ||| ||||||||||||||||||||||||| |
|
|
| T |
3782539 |
gtgtgtggcgtggttgttggttcacggttgaatcatttcattgactcgcatgcatca |
3782595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 35 - 118
Target Start/End: Original strand, 3763704 - 3763794
Alignment:
| Q |
35 |
atggctgaatctgaataggtgtgtggcgtagttgttggctcatga------ttgcgtcatttcattgactcgcatgcatca-tataaagaa |
118 |
Q |
| |
|
||||||||||| |||| ||||| |||||| ||||||||||||||| ||||||||||| | |||||| ||||||||| ||||||||| |
|
|
| T |
3763704 |
atggctgaatcagaatgggtgtatggcgtggttgttggctcatgatcatggttgcgtcattttagtgactcacatgcatcattataaagaa |
3763794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University