View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17135_low_16 (Length: 261)
Name: NF17135_low_16
Description: NF17135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17135_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 38846827 - 38846579
Alignment:
| Q |
1 |
tgttgtcggtgttaacgagaaggaatacaaaccagagcttaacattgtttccaatgctagttgcactaccaattgccttgctcccctcgccaaggnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38846827 |
tgttgtcggtgttaacgagaaagaatacaaaccagagcttaacattgtttccaatgctagttgcactaccaattgccttgctcccctcgccaaggttttt |
38846728 |
T |
|
| Q |
101 |
nnncattacctttttaacatgtttattggtttgggttaaattattagcttcattggataaaattattaatcttaactctttgcaggttattaatgaccga |
200 |
Q |
| |
|
||||||| |||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38846727 |
tttcattacccttttaatatgtttattggttagggttaaattattagcttcattggataaaattattaatcttaactctttgcaggttattaatgaccga |
38846628 |
T |
|
| Q |
201 |
tttggaattgttgagggtcttatgaccacggtccacgccatcacaggtt |
249 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38846627 |
tttggaatcgttgagggtcttatgaccacagtccacgccatcacaggtt |
38846579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 18659337 - 18659417
Alignment:
| Q |
1 |
tgttgtcggtgttaacgagaaggaatacaaaccagagcttaacattgtttccaatgctagttgcactaccaattgccttgc |
81 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||| || | || || ||||||||||| ||||||||||| |||||||| |
|
|
| T |
18659337 |
tgttgttggtgttaacgagaaggaatacaagccagagtttgatatcgtctccaatgctagctgcactaccaactgccttgc |
18659417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 42991552 - 42991472
Alignment:
| Q |
1 |
tgttgtcggtgttaacgagaaggaatacaaaccagagcttaacattgtttccaatgctagttgcactaccaattgccttgc |
81 |
Q |
| |
|
|||||| ||||| || |||||||||||||| |||||| || | || | ||||||||||||||||||||||| |||||||| |
|
|
| T |
42991552 |
tgttgttggtgtcaatgagaaggaatacaagccagagtttgatatcatctccaatgctagttgcactaccaactgccttgc |
42991472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University