View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17135_low_8 (Length: 333)
Name: NF17135_low_8
Description: NF17135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17135_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 315
Target Start/End: Original strand, 44607341 - 44607656
Alignment:
| Q |
1 |
gcatgagttcacgtgaggtgctttgacgtgccaatctagcagaggcagatcgttgaaccaccctatttgatgaggaggttcgaccatgacggttgcaggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44607341 |
gcatgagttcacgtgaggtgctttgacgtgccaatctagcagaggcagatcgttgaaccaccctatttgatgaggaggttcgaccatgacggttgcaggt |
44607440 |
T |
|
| Q |
101 |
agagagggaacggaagggagtggaggccttgtgggggttctttgacgatgaatcaggttcatcgtcattttgagctttgcgaaaggattgcatggtaaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44607441 |
agagagggaacggaagggagtggaggccttgtgggggttctttgatgatgaaccgggttcatcgtcattttgagctttgcgaaaggattgcatggtaaga |
44607540 |
T |
|
| Q |
201 |
atatttggtaatgtgatgtgatgagaatttgcaaaagtagnnnnnnnnncttacaatg--ttgtgttttgttgttgtgattgggggagcgttgttagcgg |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44607541 |
atatttggtaatgtgatgtgatgagaatttgcaaaagtag-tttttttgcttagaatgttttgtgttttgttgttgtgattgggggagcgttcttagcgg |
44607639 |
T |
|
| Q |
299 |
tgaaaccatgcaatagt |
315 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
44607640 |
tgaaaccatgcaatagt |
44607656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University