View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17137_high_1 (Length: 307)
Name: NF17137_high_1
Description: NF17137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17137_high_1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 13 - 292
Target Start/End: Original strand, 34902385 - 34902666
Alignment:
| Q |
13 |
aaggaaattaatacaaaaaattct--aattaaggaggcaaagtaaaagaaccggaaccaggttgtttaagagggactttgacaacttctttaacacctct |
110 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34902385 |
aaggaaattaatacaaaaaattctctaattaaggaggcaaagtaaaagaaccggaaccaggttgtttaagagggactttgacaacttctttaacacctct |
34902484 |
T |
 |
| Q |
111 |
tacaatccctacatcttcatccaatgtgaacaaatcttctgtttctctcaacacagcatgaatcaacacaacacctagggcaaaacacataccaacttcc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34902485 |
tacaatccctacatcttcatccaatgtgaacaaatcttctgtttctctcaacacagcatgaatcaacacaacacctagggcaaaacacataccaacttcc |
34902584 |
T |
 |
| Q |
211 |
acattatgtgttacatccgttagaacaagcaaaccgccggtgatcgacaacaaagatataaccacatatctctcatcaattt |
292 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34902585 |
acattatgtgttacatccgttagaacgagcaaaccggcggtgatcgacaacaaagatataaccacatatctctcatcaattt |
34902666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University