View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17137_low_2 (Length: 296)
Name: NF17137_low_2
Description: NF17137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17137_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 282
Target Start/End: Complemental strand, 44965109 - 44964828
Alignment:
| Q |
1 |
tggttctcaaaagggatatttcttgcaatctcttatcttttcgtgatttttctttgtgacccatgtctgtatagatgtggatttggcaacaatgaagcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44965109 |
tggttctcaaaagggatatttcttgcaatctcttatcttttcgtgatttttctttgtgacccatgtctgtatagatgtggatttggcaacaatgaagcta |
44965010 |
T |
|
| Q |
101 |
aattaaaagtagcattgtttggagtatgggatagtgcaacatgaaagaaaaatatgttgtgttgtaatgtattgaatgtatcacatatgctatgttgtta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44965009 |
aattaaaagtagcattgtttggagtatgggatagtgcaacatgaaagaaaaatatgttgtgttgtaatgtattgaatgtatcacatatgctatgttgtta |
44964910 |
T |
|
| Q |
201 |
tccgcatgcaaaggatcaaattgatgtcctagaatagaatgctacgttattggtgcaagagcacctatgttgttggtctctg |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44964909 |
tccgcatgcaaaggatcaaattgatgtcctagaatagaatgctacgttattggttcaagagcacctatgttgttggtctctg |
44964828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 40068440 - 40068400
Alignment:
| Q |
1 |
tggttctcaaaagggatatttcttgcaatctcttatctttt |
41 |
Q |
| |
|
|||| |||||||| |||||||||||| |||||||||||||| |
|
|
| T |
40068440 |
tggtcctcaaaagcgatatttcttgcgatctcttatctttt |
40068400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University