View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17138_high_3 (Length: 251)
Name: NF17138_high_3
Description: NF17138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17138_high_3 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 15 - 251
Target Start/End: Original strand, 41350007 - 41350243
Alignment:
| Q |
15 |
aggtggtagataattcattgtgtccattgaaaaagttgttgatattggaggaggtagtgatgactggacttgattccatgtttcagagctcaaaccattt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41350007 |
aggtggtagataattcattgtgtccattgaaaaagttgttgatattggaggaggtagtgatgactggacttgattccatgtttcagagctcaaaccattt |
41350106 |
T |
|
| Q |
115 |
atagaatcctggaagtattgatcggtttgcagattacaactgctttctgttgttgttccatgaagtgaatcactagactcaaacatgaaaatagggcatg |
214 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
41350107 |
atagaatcttggaagtattgatcggtttgcagattacaactgctttctgttgttgttccatgaagtgaatcactaggctcaaacataaaaatagggcatg |
41350206 |
T |
|
| Q |
215 |
tgggagaaaacaaggttgtttctggtggttttgctgt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41350207 |
tgggagaaaacaaggttgtttctggtggttttgctgt |
41350243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University