View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17138_high_4 (Length: 242)
Name: NF17138_high_4
Description: NF17138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17138_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 131 - 233
Target Start/End: Complemental strand, 25300495 - 25300393
Alignment:
| Q |
131 |
tttgttggaggttattttggcttgtaatcgatttgtttattttttattagaatacccctttattgtaacgatgtattttggatcttttaatgtattagta |
230 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
25300495 |
tttgttggaggtttttttggcttgtaatagatttgtttattttttattagacaacccctttattgtaacgatgtattttggatctttaaatgtatgagta |
25300396 |
T |
 |
| Q |
231 |
tat |
233 |
Q |
| |
|
||| |
|
|
| T |
25300395 |
tat |
25300393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University