View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17138_low_2 (Length: 274)
Name: NF17138_low_2
Description: NF17138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17138_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 10 - 246
Target Start/End: Original strand, 44727256 - 44727492
Alignment:
| Q |
10 |
tttcgcacctttactaaactaggaggcatcctaagaaaaacagtaactcccaacgcgcttttattgtctatgtccatggaaacaatgatattaagaaaac |
109 |
Q |
| |
|
|||||||||| |||| || ||||||||||| ||||||| ||||||||| ||||||||| |||| |||||||||||||||||||||||| ||| |||||| |
|
|
| T |
44727256 |
tttcgcacctctactgaaataggaggcatctcaagaaaagcagtaactctcaacgcgctcttatcgtctatgtccatggaaacaatgattttaggaaaac |
44727355 |
T |
|
| Q |
110 |
cttttggtgctttaggtattttagttagtttgagatatcctaaaagatggttttcttcaaccttctgtccctcaccttcgtaaacaacaatcaatgccgc |
209 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44727356 |
cttttggtgctttaggtatttcagttagtttgaaatatcctaaaagttggttttcttcaaccttctgtccctcaccttcgtaaacaacgatcaatgccgc |
44727455 |
T |
|
| Q |
210 |
agtttgattatcatgaatagttgtcaatactatatcc |
246 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
44727456 |
agtttgattatcatgaatagttgtcaaaagtatatcc |
44727492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 144 - 233
Target Start/End: Complemental strand, 47843539 - 47843450
Alignment:
| Q |
144 |
atatcctaaaagatggttttcttcaaccttctgtccctcaccttcgtaaacaacaatcaatgccgcagtttgattatcatgaatagttgt |
233 |
Q |
| |
|
|||||| ||||| |||||||||||| |||||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47843539 |
atatcccaaaaggtggttttcttcagccttctgtccctcaccttcgtagacaaggatcaatgcctcagtttgattatcatgaatagttgt |
47843450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 109 - 220
Target Start/End: Original strand, 47844863 - 47844974
Alignment:
| Q |
109 |
ccttttggtgctttaggtattttagttagtttgagatatcctaaaagatggttttcttcaaccttctgtccctcaccttcgtaaacaacaatcaatgccg |
208 |
Q |
| |
|
||||||||||||| |||||||| ||||| ||||| |||||| ||||| || || ||||||||||||||| ||||||||||||| |||| |||||||| | |
|
|
| T |
47844863 |
ccttttggtgcttcaggtatttcagttattttgaaatatcccaaaaggtgattctcttcaaccttctgtgcctcaccttcgtagacaatgatcaatgctg |
47844962 |
T |
|
| Q |
209 |
cagtttgattat |
220 |
Q |
| |
|
|||||||||||| |
|
|
| T |
47844963 |
cagtttgattat |
47844974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 233
Target Start/End: Original strand, 42926393 - 42926471
Alignment:
| Q |
155 |
gatggttttcttcaaccttctgtccctcaccttcgtaaacaacaatcaatgccgcagtttgattatcatgaatagttgt |
233 |
Q |
| |
|
||||| |||||| | |||||| ||||||||||||| ||||| ||||| ||| ||||||||| ||||||||| ||||| |
|
|
| T |
42926393 |
gatgggtttctttagccttctctccctcaccttcgatgacaactatcaacgcctcagtttgataatcatgaattgttgt |
42926471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 139 - 233
Target Start/End: Complemental strand, 808689 - 808595
Alignment:
| Q |
139 |
ttgagatatcctaaaagatggttttcttcaaccttctgtccctcaccttcgtaaacaacaatcaatgccgcagtttgattatcatgaatagttgt |
233 |
Q |
| |
|
|||| ||||||||| | ||||||||||| |||||| ||||||||||||||| |||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
808689 |
ttgaaatatcctaacaagtggttttcttctgccttctttccctcaccttcgtacacaagtatcaatgcctcagtttgattatcatgaatagttgt |
808595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University