View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17139_high_8 (Length: 300)
Name: NF17139_high_8
Description: NF17139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17139_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 18 - 211
Target Start/End: Complemental strand, 38533061 - 38532868
Alignment:
| Q |
18 |
atatactagtagtatttaaaaatcatgatctaaaatgagtgagaatgaaatgaatctctcaaatgaagggttgaagtcaggtatcannnnnnnatgcttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38533061 |
atatactagtagtatttaaaaatcatgatctaaaatgagtgagaatgaaatgaatctctcaaatgaagggttgaagtcaggtatcatttttttatgcttt |
38532962 |
T |
 |
| Q |
118 |
gaaaccgtgttacacatttgtgaagaagcttttattagactctccttattgtgtttctaatctatttatgtacatgtggggataaactttgctt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38532961 |
gaaaccgtgttacacatttgtgaagaagcttttattagactctccttattgtgtttctaatctatttatgtacatgtggggataaactttgctt |
38532868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University