View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17139_low_10 (Length: 281)
Name: NF17139_low_10
Description: NF17139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17139_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 9 - 262
Target Start/End: Original strand, 10689655 - 10689911
Alignment:
| Q |
9 |
gatctcaaacctctcgttgactgagaaatataagcattgcagaagcattt---ggatttagattttccggagccaccaccaccggtgaacataacaacaa |
105 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||| ||||||| |||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
10689655 |
gatctcaaacctctggttgaccgagaaatataagcattgcaggagcattttttggatttagattttccggagccatcaccaccagtgaacataacaacaa |
10689754 |
T |
|
| Q |
106 |
actgggaagtgcaaacataaaaaaggccacatacgttgttccgaagcatgtaaaagaggtcccgaaaggattcttcccaacccacttgtcgtttccttaa |
205 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10689755 |
accgggaagtgcaaacataaaaaaggccacatacgttgttccgaagcatgtaaaagaggtcccgaaaggattcttcccaacccacttgtcgtttccttaa |
10689854 |
T |
|
| Q |
206 |
gaactccagttcttcttctgcagttgacgagttcaacactgatatgatagaagaagg |
262 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
10689855 |
gaactccagttcttcttctgcagttgatgagttcaatactgatatgatagaagaagg |
10689911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 121 - 218
Target Start/End: Complemental strand, 43555365 - 43555268
Alignment:
| Q |
121 |
cataaaaaaggccacatacgttgttccgaagcatgtaaaagaggtcccgaaaggattcttcccaacccacttgtcgtttccttaagaactccagttct |
218 |
Q |
| |
|
||||||| |||||||||| ||| ||||||||||||||| ||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
43555365 |
cataaaagaggccacatatgttcttccgaagcatgtaatagaggtcatgaaaggattcttcccaagccacttgtcgtttccttaagaactccaattct |
43555268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 15 - 118
Target Start/End: Complemental strand, 43556888 - 43556791
Alignment:
| Q |
15 |
aaacctctcgttgactgagaaatataagcattgcagaagcatttggatttagattttccggagccaccaccaccggtgaacataacaacaaactgggaag |
114 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||||||||||| || |||||| | ||||| |||||||| |||| ||||||||||| |
|
|
| T |
43556888 |
aaacctctggttgactgagaaatataagcattgcatgagcatttggattta------ccagagccatcgccaccagtgaacatcacaataaactgggaag |
43556795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 220 - 258
Target Start/End: Complemental strand, 43555166 - 43555128
Alignment:
| Q |
220 |
cttctgcagttgacgagttcaacactgatatgatagaag |
258 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
43555166 |
cttctgcagttgatgagctcaacactgatatgatagaag |
43555128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University