View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17139_low_11 (Length: 249)
Name: NF17139_low_11
Description: NF17139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17139_low_11 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 13 - 131
Target Start/End: Original strand, 43353678 - 43353797
Alignment:
| Q |
13 |
gaaaacaaacatgagttggatttgatttcattattgagtttatttcca-tgtggctgatagttgaggagaactgatacatacatagacacactaagctgc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43353678 |
gaaaacaaacatgagttggatttgatttcattattgagtttatttccactgtggctgatagttgaggagaactgatacatacatagacacactaagctgc |
43353777 |
T |
 |
| Q |
112 |
tggcacaccccatatgtggc |
131 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
43353778 |
tggcacaccccatatgtggc |
43353797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 163 - 246
Target Start/End: Original strand, 43353829 - 43353912
Alignment:
| Q |
163 |
gtccattcaacttcaccttctctcttctatctgcacggtcatttcttttttccatttccatccacttacttccttctcttcacc |
246 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43353829 |
gtccattcaacttcatcttctctcttctatctgcagagtcatttcttttttccatttccatccacttacttctttctcttcacc |
43353912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 163 - 249
Target Start/End: Original strand, 1034543 - 1034629
Alignment:
| Q |
163 |
gtccattcaacttcaccttctctcttctatctgcacggtcatttcttttttccatttccatccacttacttccttctcttcaccacc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1034543 |
gtccattcaacttcaccttctctcttctatctgcacagtcatttcttttttccatttccatccacttacttctttctcttcaccacc |
1034629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 90 - 131
Target Start/End: Original strand, 1034470 - 1034511
Alignment:
| Q |
90 |
atacatagacacactaagctgctggcacaccccatatgtggc |
131 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1034470 |
atacatagacacactaagctgctggcacaacccatatgtggc |
1034511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University