View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1713_high_3 (Length: 212)
Name: NF1713_high_3
Description: NF1713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1713_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 34 - 191
Target Start/End: Complemental strand, 4999393 - 4999236
Alignment:
| Q |
34 |
atcatgatcaagcaatatattattactcttcacatccctatgaacaatagcaggaacacaatcatggtgtaaataagccaaccctttagcagcacctaaa |
133 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4999393 |
atcatgatcaagcaatatgttattactcttcacatccctatgaacaatagcaggaacacaatcatggtgtaaataagccaaccctttagcagcacctaaa |
4999294 |
T |
 |
| Q |
134 |
gcaattccaaatctcttagaccaatccaactccacaaacttctcctcatgcaaaacat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4999293 |
gcaattccaaatctcttagaccaatccaactccacaaacttcccctcatgcaaaacat |
4999236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 113
Target Start/End: Complemental strand, 21468560 - 21468521
Alignment:
| Q |
74 |
tgaacaatagcaggaacacaatcatggtgtaaataagcca |
113 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
21468560 |
tgaacaataggaggagcacaatcatggtgtaaataagcca |
21468521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 44 - 110
Target Start/End: Complemental strand, 38868357 - 38868291
Alignment:
| Q |
44 |
agcaatatattattactcttcacatccctatgaacaatagcaggaacacaatcatggtgtaaataag |
110 |
Q |
| |
|
|||||||||||| || || ||||||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
38868357 |
agcaatatattactagattttacatccctatgaacaataggaacaacacaatcatggtgcaaataag |
38868291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University